Bio 201 Final Review

Last Updated: 07 Jul 2020
Essay type: Process
Pages: 19 Views: 1181

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? - The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. - TRUE ________can convert proto-oncogenes into oncogenes. - Nonsense mutations Most human embryos that are aneuploidy - are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. - FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? - 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.

If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. - BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? - mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called - maternal effects.

If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits - are on the same chromosome. An episome is - a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. - FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. - an F factor What can be inferred from an organism that has undergone a gene knockout? - The GMO is a homozygote and the cloned gene carries a mutation.

Order custom essay Bio 201 Final Review with free plagiarism report

feat icon 450+ experts on 30 subjects feat icon Starting from 3 hours delivery
Get Essay Help

Which of the following is an example of a clone on the organism level? - identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? - G1 Certain types of cancer are caused by viruses. - TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as - both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.

Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to - get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? - random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain - All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. - FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. - TRUE Which of the following does not contribute to the infectious ability of prions? - Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that - their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? - Plant cells are totipotent. Which of the following is an advantage of molecular pharming? - The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC

Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp - base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. - FALSE A gene created from the fusion of two gene fragments is considered a - chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. - FALSE In a tetraploid species, a euploid individual would have ___sets of chromosomes. - 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? - F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.

This indicates that - two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. - FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is - codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance - can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. - competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that - their protein structures are very complex.

Bacteria can exchange DNA between strains of the same species and between different species. - TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? - xeroderma pigmentosum Cancers originate from a single cell. - TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? - two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? - centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.

What is the probability that their next child will have blue eyes and be nearsighted? - 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? - Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. - TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.

This is because - All of the statements given are true. Quantitative traits - are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and length are linked, what would be a possible ratio for the F2 population? | - 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. - TRUE

A particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is - a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. - TRUE Which of the following is a possible use for gene cloning? - All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? - Every band matches. What is required for a group of clones to be considered a contig? - The clones should have overlapping regions of DNA.

A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? - nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be - metastatic. The process by which haploid cells are produced from diploid cells is called - meiosis In a haploid dominant species - the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that - alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.

What is the genotype and phenotype of the parents that produced this population? - both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? - either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called - epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. - 3,2

Drugs that are HIV protease inhibitors - prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. - TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. - TRUE The entire collection of a species' proteins is known as its - proteome Which of the following pollutants could be reduced with the use of bioremediation? - All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. - TRUE

What would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? - a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. - FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) - oncogene The formation of the bivalent during meiosis - contributes to the genetic diversity of a species.

A male is heterozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. - 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. - TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. - FALSE Which of the following statements correctly describes a quantitative trait? - People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. - a sex pilus, single strand of DNA Integrase - cuts the viral genome and is required for both prophage and provirus formation.

Which of the following is an advantage of cDNA libraries? - cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage - TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. - FALSE In mammals, males are ________ and females are ____________. - hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. - 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. - cytoplasm Place the following events of bacterial transformation in order from first to last. - DNA replication b - an enzyme joins F factor DNA ends c - sex pilus shortens d - DNA transfer e - an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? - plasmid and viral vector

Which of the following statements is TRUE of restriction enzymes? - They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.

Which of the following is an overgrowth of cells that serves no useful purpose? - tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. - two haploid, 4 haploid Which of the following mutations will not alter the amount of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. - TRUE The sex of all animals is determined by chromosomes. - FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.

A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? - missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? - Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosses performed by Mendel support the observation that - the two alleles for a given gene are distributed randomly among an individual's gametes.

Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission - All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. - supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? - A cDNA library is derived from mRNA and is made using reverse transcriptase.

Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense Should a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. - checkpoint proteins In mitosis, the main difference between plant and animal cells is that - plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.

A normal couple has a color-blind child. Who else in this family is probably color blind? - the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? - Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.

Which of the following DNA repair systems is responsible for the correction? - direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce - a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? - 5? 10?

A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in - an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant "rescue" could have been caused by - addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? - Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.

Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? - cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone - gene amplification. All of the following are chemical mutations EXCEPT - X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? - Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is - pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? - Triple X syndrome Prokaryotes - include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUE

Bacterial infections have become much more of a threat to human health due to - All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. - S Sexual life cycles include both haploid and diploid stages. - TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.

If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.

A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the other parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce "Labradoodles" is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.

Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and metaphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.

What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breeding a new variety of houseplant in which two genes control leaf color.

G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow "Texas Beauty" rose with a true-breeding "Ruby" red rose, you get all red roses. But when you cross a "Texas Beauty" yellow with the yellow variety "Jealousy," you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSE

A scientist has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.

However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.

Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.

A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? - The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? - All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins - do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because - if both parents are carriers, they have a 50% chance of having normal children.

Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. - IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because - HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in - the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.

However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? - polymerase chain reaction (PCR) Polyploidy in plants - All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, - chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because - they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? - 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? - A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSE

Polydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.

Cite this Page

Bio 201 Final Review. (2017, Mar 08). Retrieved from https://phdessay.com/bio-201-final-review/

Don't let plagiarism ruin your grade

Run a free check or have your essay done for you

plagiarism ruin image

We use cookies to give you the best experience possible. By continuing we’ll assume you’re on board with our cookie policy

Save time and let our verified experts help you.

Hire writer